View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10521_low_60 (Length: 204)
Name: NF10521_low_60
Description: NF10521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10521_low_60 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 41 - 190
Target Start/End: Complemental strand, 8907488 - 8907344
Alignment:
| Q |
41 |
tattacttctctccttcttgtagataaataggtcgcagctaattagagctcttctcccttccttaattaagagtgtattctctaaaaatcgaacctcagt |
140 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8907488 |
tattacttctctcctt---gtagataaataggtcgcagctaattagagctcttctcccttccttaattaagagtgtattctctaaaaatcgaacctcagt |
8907392 |
T |
 |
| Q |
141 |
ccaacccgacaaactcaatgttgtttaatcaaccgaagagcattgctatt |
190 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||| ||||||||| |
|
|
| T |
8907391 |
ccaacccgacaaactc--tgttgcttaatcaaccgaagagtattgctatt |
8907344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University