View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10522_low_2 (Length: 256)

Name: NF10522_low_2
Description: NF10522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10522_low_2
NF10522_low_2
[»] chr4 (2 HSPs)
chr4 (19-251)||(35020549-35020781)
chr4 (68-131)||(1558290-1558353)
[»] chr1 (2 HSPs)
chr1 (68-171)||(48769986-48770089)
chr1 (45-171)||(8455411-8455537)
[»] chr5 (1 HSPs)
chr5 (68-159)||(18979958-18980049)
[»] scaffold0060 (1 HSPs)
scaffold0060 (78-171)||(19002-19095)
[»] chr8 (1 HSPs)
chr8 (45-171)||(19168253-19168379)


Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 19 - 251
Target Start/End: Complemental strand, 35020781 - 35020549
Alignment:
19 atagaagccttgtttttcttcttctttttggatggttgctaaatttatattagtgggatatatttcattgttttgatgtttggtctttttcttttgttgg 118  Q
    |||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| ||| ||    
35020781 atagaagcattgtttttcttcttctttttggatgattgctaaatttatattagtggaatatatttcattgttttaatgtttggtctttttcttctgtagg 35020682  T
119 gttagatttgttgctagacttggctgcatttctttgtttagccgtttaggtttatttgattaagagaaatattaacgaatgccttgaattaaaagcaaag 218  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |  |||||||||||| ||||     
35020681 gttagatttgttgctagacttggctgcatttttttgtttagccgtttagatttatttgattaagagaaatattaacgagtatcttgaattaaaaacaaaa 35020582  T
219 tttaagctagatgtttcaagtgtctctgcttct 251  Q
    ||||||||||||||||||||||||| |||||||    
35020581 tttaagctagatgtttcaagtgtctttgcttct 35020549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 68 - 131
Target Start/End: Complemental strand, 1558353 - 1558290
Alignment:
68 ttagtgggatatatttcattgttttgatgtttggtctttttcttttgttgggttagatttgttg 131  Q
    |||||||||||  ||| ||||||| ||| |||||||||| |||||||| | |||||||||||||    
1558353 ttagtgggataattttgattgtttagatatttggtctttctcttttgtagtgttagatttgttg 1558290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 68 - 171
Target Start/End: Original strand, 48769986 - 48770089
Alignment:
68 ttagtgggatatatttcattgttttgatgtttggtctttttcttttgttgggttagatttgttgctagacttggctgcatttctttgtttagccgtttag 167  Q
    |||||||||||| ||| ||||||| ||| |||| ||||| |||||||| | ||||||||||||| |   | |||||||||||| ||||||||| | ||||    
48769986 ttagtgggatatttttgattgtttagatatttgatctttctcttttgtagtgttagatttgttggtgatcatggctgcatttccttgtttagcagcttag 48770085  T
168 gttt 171  Q
    ||||    
48770086 gttt 48770089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 45 - 171
Target Start/End: Complemental strand, 8455537 - 8455411
Alignment:
45 tttggatggttgctaaatttatattagtgggatatatttcattgttttgatgtttggtctttttcttttgttgggttagatttgttgctagacttggctg 144  Q
    |||||||||||| ||| | ||| ||||||||||| ||||  |||||||||| |||||||||| |||| | | | | | ||| ||||| |  |||||||||    
8455537 tttggatggttgataattctatcttagtgggatagatttgtttgttttgatatttggtctttctcttatatagtgatcgatatgttgatgaacttggctg 8455438  T
145 catttctttgtttagccgtttaggttt 171  Q
    | |||| ||||||||| ||| ||||||    
8455437 cttttccttgtttagcagttcaggttt 8455411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 68 - 159
Target Start/End: Original strand, 18979958 - 18980049
Alignment:
68 ttagtgggatatatttcattgttttgatgtttggtctttttcttttgttgggttagatttgttgctagacttggctgcatttctttgtttag 159  Q
    |||||||||||  ||| ||||||| ||| |||||||||| |||||||| | ||||||||||||| |   | |||||||||||| ||||||||    
18979958 ttagtgggataattttgattgtttagatatttggtctttctcttttgtagtgttagatttgttggtgatcatggctgcatttccttgtttag 18980049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0060
Description:

Target: scaffold0060; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 78 - 171
Target Start/End: Original strand, 19002 - 19095
Alignment:
78 atatttcattgttttgatgtttggtctttttcttttgttgggttagatttgttgctagacttggctgcatttctttgtttagccgtttaggttt 171  Q
    |||||| ||||||||||| |||||||||| |||||| | | | ||||| ||||| |  |||||||||| |||| ||||||||| ||| ||||||    
19002 atatttgattgttttgatatttggtctttctcttttatagtgctagatatgttgatgaacttggctgcttttcattgtttagcagttcaggttt 19095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 45 - 171
Target Start/End: Original strand, 19168253 - 19168379
Alignment:
45 tttggatggttgctaaatttatattagtgggatatatttcattgtttt-gatgtttggtctttttcttttgttgggttagatttgttgctagacttggct 143  Q
    |||||||||||| ||| | ||| |||||| |||| |||| ||| |||| ||| |||||||||| |||||| | | | ||||| ||||| |  ||||||||    
19168253 tttggatggttgataattctatcttagtgtgatagatttgattttttttgatatttggtctttctcttttatagtgctagatatgttggtgaacttggct 19168352  T
144 gcatttctttgtttagccgtttaggttt 171  Q
    ||| ||| ||||||||| ||||||||||    
19168353 gca-ttccttgtttagcagtttaggttt 19168379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University