View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10524_low_1 (Length: 250)
Name: NF10524_low_1
Description: NF10524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10524_low_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 36348881 - 36349118
Alignment:
| Q |
1 |
tccaaaattaacatgcatatatatttaagctgcaaagactcacctcaagttgttcattgagtcttctctgaacctcaatctgcatttgcagcgcctcact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36348881 |
tccaaaattaacatgcatatatatttaagctgcaaagactcacctcaagttgttcattgagtcttctctgaacctcaatctgcatttgcagcgcctcact |
36348980 |
T |
|
| Q |
101 |
tatgtgcaaatctctaccaaaagggatatgaaagtcagcataaaatcttaaagtggtagagttttcatataaaacaagattacattaagagtgtgattaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36348981 |
tatgtgcaaatctctaccaaaagggatatgaaagtcagcataaaatcttaaagtggtagagttttcatataaaacaagattacattaagagtgtgattaa |
36349080 |
T |
|
| Q |
201 |
aaaagggttttgtttttcttacttgttgttattagtct |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36349081 |
aaaagggttttgtttttcttacttgttgttattagtct |
36349118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University