View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10525_high_6 (Length: 240)
Name: NF10525_high_6
Description: NF10525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10525_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 30251834 - 30252055
Alignment:
| Q |
1 |
tttaaatgaaggagaaaatgacataccttaatactcgaatatcttaaagggcaagaaatccattggatgggagggaggctgtaagagtttaaaaggagag |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30251834 |
tttaaatgaaggagaaaacgacataccttaatactcgaatatcttagagggcaagaaatccattggatgggagggaggct--aagagtttaaaaggagag |
30251931 |
T |
|
| Q |
101 |
agtaattgtgnnnnnnnncaagtctttcattcaacctaaacaaagaacactcgacctcatgtgccatatcttatacggcttggacaggggcaaagttatg |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30251932 |
agtaattgtgaaaaaagacaagtctttcattcaacctaaacaaagaacactcgacctcatgtgccatatcttatacggcttggacaggggcgaagttatg |
30252031 |
T |
|
| Q |
201 |
tgttattatggggtagctttagtt |
224 |
Q |
| |
|
|||||| ||||||||||||||||| |
|
|
| T |
30252032 |
tgttataatggggtagctttagtt |
30252055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University