View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10525_low_11 (Length: 255)
Name: NF10525_low_11
Description: NF10525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10525_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 11 - 240
Target Start/End: Original strand, 28663150 - 28663379
Alignment:
| Q |
11 |
cagagatcagagagaagttccgggatgcgaaacttcaagtatgtaaaaaccatcaaagctgctgtggagaaagaatgtcccttgacagtatcatgtgccg |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28663150 |
cagacatcagagagaagttccgggatgcgaaacttcaagtatgtaaaaaccatcaaagctgctgtggagaaagaatgtcccttgacagtatcatgtgccg |
28663249 |
T |
|
| Q |
111 |
acattgttgctctttccgctagagacggaattgccatggtatgttaagagtcgcacattagaaatcccagataaaaattgagacttaaaattaaaagatt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28663250 |
acattgttgctctttccgctagagacggaattgccatggtatgttaagagtcgcacattagaaatcccacataaaaattgagacttaaaattaaaagatt |
28663349 |
T |
|
| Q |
211 |
tttatgttggtgcatttgtatagttgggag |
240 |
Q |
| |
|
|||||| || |||||||||||||||||||| |
|
|
| T |
28663350 |
tttatgctgttgcatttgtatagttgggag |
28663379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 23 - 154
Target Start/End: Original strand, 28654760 - 28654891
Alignment:
| Q |
23 |
agaagttccgggatgcgaaacttcaagtatgtaaaaaccatcaaagctgctgtggagaaagaatgtcccttgacagtatcatgtgccgacattgttgctc |
122 |
Q |
| |
|
||||||| |||||| |||| ||||||||||| || ||||||||||||||||| ||||||||||||||||||||||| |||||||| || |||||||||| |
|
|
| T |
28654760 |
agaagttttgggatgagaaatttcaagtatgtgaacaccatcaaagctgctgttgagaaagaatgtcccttgacagtgtcatgtgctgatattgttgctc |
28654859 |
T |
|
| Q |
123 |
tttccgctagagacggaattgccatggtatgt |
154 |
Q |
| |
|
|||| ||||||||||| ||||| ||||||||| |
|
|
| T |
28654860 |
tttctgctagagacggtattgcaatggtatgt |
28654891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 7 - 154
Target Start/End: Original strand, 28605295 - 28605442
Alignment:
| Q |
7 |
ggagcagagatcagagagaagttccgggatgcgaaacttcaagtatgtaaaaaccatcaaagctgctgtggagaaagaatgtcccttgacagtatcatgt |
106 |
Q |
| |
|
|||||||| | | |||||||||| |||||| |||||||||||||||| | ||||||||||||||| | || ||||||||||| |||||||| ||||| |
|
|
| T |
28605295 |
ggagcagacagcggagagaagttttgggatgagaaacttcaagtatgtgagcaccatcaaagctgctcttgaaaaagaatgtcctttgacagtgtcatgc |
28605394 |
T |
|
| Q |
107 |
gccgacattgttgctctttccgctagagacggaattgccatggtatgt |
154 |
Q |
| |
|
|| ||||||||||||||||| ||||||||||| ||||||| ||||||| |
|
|
| T |
28605395 |
gctgacattgttgctctttctgctagagacggtattgccagggtatgt |
28605442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 7 - 154
Target Start/End: Original strand, 28635463 - 28635610
Alignment:
| Q |
7 |
ggagcagagatcagagagaagttccgggatgcgaaacttcaagtatgtaaaaaccatcaaagctgctgtggagaaagaatgtcccttgacagtatcatgt |
106 |
Q |
| |
|
|||||||| ||| | |||||||| |||||| |||| ||||||||||| || ||||||||||| ||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
28635463 |
ggagcagacatcggtgagaagttttgggatgagaaatttcaagtatgtgaataccatcaaagcagctgtcgagaaagaatgtcccttgacagtgtcatgc |
28635562 |
T |
|
| Q |
107 |
gccgacattgttgctctttccgctagagacggaattgccatggtatgt |
154 |
Q |
| |
|
|| |||||||| ||||| || ||||||||||| ||||| ||||||||| |
|
|
| T |
28635563 |
gctgacattgtcgctctatctgctagagacggtattgcaatggtatgt |
28635610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University