View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10525_low_17 (Length: 229)
Name: NF10525_low_17
Description: NF10525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10525_low_17 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 7 - 229
Target Start/End: Complemental strand, 13629447 - 13629234
Alignment:
| Q |
7 |
gtggtaactaataagtatccgaaatatgttggtttagtaaccaaggtataggcttctgctatatagttcagtatgagaaagcatacatcttgaatggaat |
106 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13629447 |
gtggtaactaataagtatctgaaatatgttggtttaataaccaaggtataggcttctgctatatagttcagtatgagaaagcatacatcttgaat----- |
13629353 |
T |
 |
| Q |
107 |
gaataatagacgcaactatttattgtgttaaggggaatataattttgactcagatgttctggctttatgtattagtctttaggcagccttgtcactgacc |
206 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13629352 |
----aatagacgcaactatttattgtgttgaggggaatataattttgactcagatgttctggctttatgtattagtctttaggcaaccttgtcactgacc |
13629257 |
T |
 |
| Q |
207 |
ttaagttgtacattaatgttgtt |
229 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
13629256 |
ttaagttgtacattaatgttgtt |
13629234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University