View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10525_low_20 (Length: 219)
Name: NF10525_low_20
Description: NF10525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10525_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 52630469 - 52630270
Alignment:
| Q |
1 |
taaaatgcattcttcattctcccactgtcctagtactgttctcaaattggtatgtcatggtgtgtgtacttgtgtattaatataggaaagggtgaggtgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52630469 |
taaaatgcattcttcattctcccactgtcctagtactgttctcaaattggtatgtcatggtatgtgtacttgtgtattaatataggaaagggtgaggtgt |
52630370 |
T |
 |
| Q |
101 |
tgacgtgttcagaagatcgtaattcagacttgttccattctgttcttggtggtcttggacaatttggaatcatcacaagagctagaattgctcttcaacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52630369 |
tgacgtgttcagaagatcgtaattcagacttgttccattctgttcttggtggtcttggacaatttggaatcatcacaagagctagaattgctcttcaacc |
52630270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 141 - 200
Target Start/End: Original strand, 35830413 - 35830472
Alignment:
| Q |
141 |
tgttcttggtggtcttggacaatttggaatcatcacaagagctagaattgctcttcaacc |
200 |
Q |
| |
|
||||||||| || ||||| |||||||| |||||||| |||||||||||| ||||| |||| |
|
|
| T |
35830413 |
tgttcttggagggcttggtcaatttggcatcatcactagagctagaatttctcttgaacc |
35830472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University