View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10525_low_26 (Length: 204)
Name: NF10525_low_26
Description: NF10525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10525_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 14 - 187
Target Start/End: Original strand, 41548124 - 41548298
Alignment:
| Q |
14 |
gcataggaccaaggcaacacttataggtttgtttgaggcaggtagggtaaatgaatgggtggttactgagaaattgggtgacgctcttaaaataaaatca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41548124 |
gcataggaccaaggcaacacttataggtttgtttgaggcaggtagggtaaatgaatgggtggttactgagaaattgggtgacgctcttaaaataaaatca |
41548223 |
T |
|
| Q |
114 |
ggaggtaaagcagctagaaagcctcgtatcacgatcgatggaaggtaaagttta-ttacccttttaacgaggata |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
41548224 |
ggaggtaaagcagctagaaagcctcgtatcactatcgatggaaggtaaagtttatttaccctttcaacgaggata |
41548298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University