View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10526_low_3 (Length: 249)
Name: NF10526_low_3
Description: NF10526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10526_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 49946379 - 49946621
Alignment:
| Q |
1 |
ttattcttcatcatatcatatcatatcata--------aaacttgtaagaggttcactcaaattgcggaaaataagcatgaaaatcattctcttttttat |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49946379 |
ttattcttcatcatatcatatcatatcatatttaattgaaacttggaagaggttcactcaaattgcggaaaataagcatgaaaatcattctcttttttat |
49946478 |
T |
 |
| Q |
93 |
ttgggtcaaaaggacaatgagtctctgaatcattggtatgagttttgtcactctcagtgaatattcagagaacatagatctcattcgaatccatctttta |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
49946479 |
ttgggtcaaaaggacaatgagtctctgaatcattggtatgagttttgtcactctcagtgaatattc--agaacatagatctcattcgaatccatctttta |
49946576 |
T |
 |
| Q |
193 |
actttatctgatgatgtcgtttttcaacctttgaaacacctgtct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49946577 |
actttatctgatgatgtcgtttttcaacctttgaaacacctgtct |
49946621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University