View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10526_low_4 (Length: 241)
Name: NF10526_low_4
Description: NF10526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10526_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 49946241 - 49946036
Alignment:
| Q |
1 |
atctgaaaatgcccaccggagaaaataaattctatgaagnnnnnnnnntaccatggaagcataatcgtttcttccactgctcggaccattctcgaatgaa |
100 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49946241 |
atctgaaaatgcccagcggagaaaatgaattctatgaagaaaaaaaaataccatggaagcataatcgtttcttccactgctcggaccattctcgaatgaa |
49946142 |
T |
|
| Q |
101 |
aaatgtggtctcaatgggaatcattacgaggattgggaagacacacaaggttttctttttgcattggagcttctcttgacgacatattaagagtgtcttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
49946141 |
aaatgtggtctcaatgggaatcattacgaggattgggaaga--cacaaggttttctttttgcattgcagcttctcttgacgacatattaagagtgtcttt |
49946044 |
T |
|
| Q |
201 |
ggatagac |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
49946043 |
ggatagac |
49946036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University