View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10526_low_6 (Length: 226)
Name: NF10526_low_6
Description: NF10526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10526_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 24 - 205
Target Start/End: Complemental strand, 32988264 - 32988087
Alignment:
| Q |
24 |
tccatgtcttcaactcagttcaaatatgttcttactcagcaacacgtatccgaaacgtgtcaaactggacccttttaacgtgtcgtccaaacctgaaaga |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32988264 |
tccatgtcttcaactcagttcaaatatgttcttacttagcaacacgtatccgaaacgtgtcaaactggacccttttaacgtgtcgtccaaacctgaaaga |
32988165 |
T |
 |
| Q |
124 |
caatgttgctttcaccgttcacatcttccataaatatcaatcaataaatatatcaacctactagcatatcataacagtgagc |
205 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
32988164 |
caatgttgctttcaccgtttatatcttccataaatatcaatc----aaaatatcaacctactagcatatcataacagtgagc |
32988087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University