View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10526_low_7 (Length: 218)
Name: NF10526_low_7
Description: NF10526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10526_low_7 |
 | |
|
| [»] scaffold0045 (1 HSPs) |
| | |
|
| [»] scaffold0457 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0045 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 12 - 200
Target Start/End: Complemental strand, 25716 - 25528
Alignment:
| Q |
12 |
aacctgtgtaagaccgatttaaaggtaagactgctaaagttctcgttttaggtctatcaatnnnnnnnttatttttattagattttataaacgaaacaag |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
25716 |
aacctgtgtaagaccgatttaaaggtaagactgctaaagttctcgttttaggtctatcaataaaaaaattatttttattggattttataaacgaaacaag |
25617 |
T |
|
| Q |
112 |
gtttcatatgcagataagaaatgtcttatatattaaaatttgttttggaccttatttactattaaaaattattggaccgacacttagac |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25616 |
gtttcatatgcagataagaaatgtctcatatattaaaatttgttttggaccttatttactattaaaaattattggaccgacacttagac |
25528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0457 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0457
Description:
Target: scaffold0457; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 127 - 200
Target Start/End: Original strand, 4327 - 4400
Alignment:
| Q |
127 |
aagaaatgtcttatatattaaaatttgttttggaccttatttactattaaaaattattggaccgacacttagac |
200 |
Q |
| |
|
|||||||||| |||||||||||||| || ||||| ||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
4327 |
aagaaatgtcgcatatattaaaatttacttcagacctcatttactattaaaaattattggaccaacacgtagac |
4400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University