View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10527_high_2 (Length: 270)
Name: NF10527_high_2
Description: NF10527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10527_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 6e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 16 - 253
Target Start/End: Original strand, 2693345 - 2693574
Alignment:
| Q |
16 |
aatgttcaatgtcgacaccaatatgtgtcagacacttgacacacattgacacatccaatctgaaatgccgaaagtctcggtgttacatttttaactatat |
115 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||| ||||| |||||||||||||| ||||||||||| ||||||||||| |||| |||| |
|
|
| T |
2693345 |
aatgttcaatgtcaacaccaatatgtgtcggacactttgcacac--------atccaatctgaaataccgaaagtctcagtgttacatttctaaccatat |
2693436 |
T |
 |
| Q |
116 |
aatttcagtacactaagactaagttaagtaggacatgtattaatttttatgcaggtcaggctgaagaagtacatggaaatgagaggtgctgatggggggc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2693437 |
aatttcagtacactaagactaagttaagtaggacatgtattaatttttatgcaggtcaggctaaagaagtacatggaaatgagaggtgctgatggggggc |
2693536 |
T |
 |
| Q |
216 |
ctttgaaaatgttatgtgctcttcctgctttttgggta |
253 |
Q |
| |
|
||||||| |||||||||||| | ||||||||||||||| |
|
|
| T |
2693537 |
ctttgaatatgttatgtgctttgcctgctttttgggta |
2693574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 185 - 261
Target Start/End: Original strand, 2685614 - 2685690
Alignment:
| Q |
185 |
tacatggaaatgagaggtgctgatggggggcctttgaaaatgttatgtgctcttcctgctttttgggtaattcatct |
261 |
Q |
| |
|
||||||||||||||||||||||||| || ||| || ||| ||||||||| || |||||||||||||||||||| |
|
|
| T |
2685614 |
tacatggaaatgagaggtgctgatgtggtccctcagagcatgctatgtgctccaccagctttttgggtaattcatct |
2685690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 167 - 252
Target Start/End: Complemental strand, 40924400 - 40924315
Alignment:
| Q |
167 |
caggtcaggctgaagaagtacatggaaatgagaggtgctgatggggggcctttgaaaatgttatgtgctcttcctgctttttgggt |
252 |
Q |
| |
|
||||| ||||| |||| ||| |||| ||||||||||||||||| ||||||| || || |||||||||| | || || |||||||| |
|
|
| T |
40924400 |
caggttaggctaaagaggtatttggagatgagaggtgctgatggagggccttggagaaggttatgtgctttaccagcattttgggt |
40924315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University