View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10527_high_4 (Length: 251)
Name: NF10527_high_4
Description: NF10527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10527_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 169
Target Start/End: Complemental strand, 23162780 - 23162614
Alignment:
| Q |
1 |
tgataatattaatttgagtgaagataagatttcaagaatgtataaaataataagaggaaaaacaaaatctatagattaatgtttgtgagataaactatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
23162780 |
tgataatattaatttgagtgaagataagatttcaagaatgtataaaataataagaggaaata--aaatctatagattaatgtttgtgagataaactatga |
23162683 |
T |
|
| Q |
101 |
acaacaacttctaatcttttgtagataggtcaatgcagtcacattctaattcttcctatcttagatgac |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
23162682 |
acaacaacttctaatcttttgtagataggtcaatgcagtcactttctaattcttcctaccttagatgac |
23162614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University