View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10527_low_10 (Length: 238)
Name: NF10527_low_10
Description: NF10527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10527_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 23162764 - 23162987
Alignment:
| Q |
1 |
tcaaattaatattatcattggattttttagatttcagcaattgtagcacttcttacggtggaagaaaattgatggaaatcatgtaatctaaactacatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23162764 |
tcaaattaatattatcattggattttttagatttcagcaattgtggcacttcttacggtggaagaaaattgatggaaatcatgtaatctaaactacatat |
23162863 |
T |
 |
| Q |
101 |
ttgttgacatgacaccttaccaaaaccccaattttctaaccnnnnnnnaactatatgttgtggtctatgagaacttaaaggaaagaaaaataatttcaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23162864 |
ttgttgacatgacaccttaccaaaaccccaattttctaacctttttttaactatatgttgtggtctatgagaacttaaaggaaagaaaaataatttcaat |
23162963 |
T |
 |
| Q |
201 |
caggagcataacactgatcaaact |
224 |
Q |
| |
|
||| |||||||||||||||||||| |
|
|
| T |
23162964 |
cagtagcataacactgatcaaact |
23162987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University