View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10527_low_7 (Length: 259)
Name: NF10527_low_7
Description: NF10527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10527_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 26 - 255
Target Start/End: Original strand, 41699601 - 41699829
Alignment:
| Q |
26 |
ctttatggaaattgcaatccaaagatttgttattttccggttcacgatttgattatgctgtatctcatacacttttgtgatgatttgattttgcatttgc |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41699601 |
ctttatggaaattgcaatccaaagatttgttattttccggttcacgatttgattatgctgtatctcatacacttttgtgatgatttgattttgcatttgc |
41699700 |
T |
 |
| Q |
126 |
tcaattgtgcaaaaattacagatttatgatgtttaatatatgttttacatattgagcattattgtaacttatttttcataaagttttaacataaatttta |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
41699701 |
tcaattgtgcaaaaattacagatttatgatgtttaatatatgttttacatattgagcattattggaacttatttttcataaag-tttaacataaatttta |
41699799 |
T |
 |
| Q |
226 |
tgttgttgttttagtcttttcttatttcat |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41699800 |
tgttgttgttttagtcttttcttatttcat |
41699829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University