View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10528_high_4 (Length: 240)
Name: NF10528_high_4
Description: NF10528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10528_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 139 - 225
Target Start/End: Complemental strand, 14266982 - 14266895
Alignment:
| Q |
139 |
aaagtgatgtgctaaatacttgtgacaatgtaagattttctgaataaagtatggtaaagaataatgag-gttttacactaaaacattc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
14266982 |
aaagtgatgtgctaaatacttgtgacaatgtaagattttctgaataaagtatggtaaagaataatgagtgtttaacactaaaacattc |
14266895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 14267120 - 14267048
Alignment:
| Q |
1 |
aatacttagttaggtacaactatttaggcatt-ctcttttgacacacacatatagtatttgataaattataga |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14267120 |
aatacttagttaggtacaactatttaggcatttctcttttgacacacacatatagtatttgataaattataga |
14267048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University