View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10528_low_11 (Length: 227)
Name: NF10528_low_11
Description: NF10528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10528_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 14267476 - 14267265
Alignment:
| Q |
1 |
aagagaggaaaaacttgtcttcacaccgttgccatacttacacatacatacaggatcatagggagtcatcctcctcattttgggtttatagtataaattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
14267476 |
aagagaggaaaaacttgtcttcacaccgttgccatacttaca--tacatacaggatcatagagagtcattcacctcattttgggtttatagtataaattt |
14267379 |
T |
|
| Q |
101 |
atgtataacttgttacatggaaaagttgtgatgcctttcgatctctcttttaattttcacatgtgtaataatatattcttaacattcacgataagatatt |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
14267378 |
atgcataacttgttacatggaaaagttgtgatgcctttcgatctctcttttaattttcacatgtgtaataatatattcttaacatttacgatgagatatt |
14267279 |
T |
|
| Q |
201 |
ttgataataaatat |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
14267278 |
ttgataataaatat |
14267265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University