View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10528_low_4 (Length: 285)
Name: NF10528_low_4
Description: NF10528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10528_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 278
Target Start/End: Complemental strand, 2833714 - 2833455
Alignment:
| Q |
18 |
gttctgttcttacacgctacgttactttgttttgcttcataccaacgagttgaaccaccgagtttagtgnnnnnnnnnnnagtgttttagttggtggagt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2833714 |
gttctgttcttacacgctacgttactttgttttgcttcataccaacgagttgaaccaccgagtttagtgtttttttttt-agtgttttagttggtggagt |
2833616 |
T |
|
| Q |
118 |
agttgtttgggagagatgaaaatgattaagagcttatttgaaacgtgagttttgtgatgtgaagtgaagatgtttcgttcttcaaaatggagaagtgaga |
217 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2833615 |
aattgtttgggagagatgaaaatgattaagagcttatttgaaacgtgagttttgtgatgtgaagtgaagatgtttcgttcttcaaaatggagaagtgaga |
2833516 |
T |
|
| Q |
218 |
agaataggattaaagctgtttttaagcttcaattcaatgctactaaggtaggttcatctca |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2833515 |
agaataggattaaagctgtttttaagcttcaattcaatgctactaaggtaggttcatctca |
2833455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University