View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10529_low_3 (Length: 278)
Name: NF10529_low_3
Description: NF10529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10529_low_3 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 40 - 278
Target Start/End: Complemental strand, 44682873 - 44682635
Alignment:
| Q |
40 |
atgaacccccggaccccactttattattacggacacaactgctgcgttctttgcccaaactctgcctcatcttggacaagttaaatgcatcaacatttac |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44682873 |
atgaacccccggaccccactttattattacggacacaactgctgcgttctttgcccaaactctgcctcatcttggacaagttaaatgcatcaacatttac |
44682774 |
T |
 |
| Q |
140 |
attattaaacacataatttcactatgtttttgcaataaaataaggatgtcaatttgaaaaatgaaatagtaggtacaatttctcgtgccttgcttgtata |
239 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44682773 |
attattaaacacataatgtcattatgtttttgcaataaaataaggatgtcaatttgaaaaatgaaatagtaggtacaatttctcgtgccttacttgtata |
44682674 |
T |
 |
| Q |
240 |
ttatcatcaagtgaagacttgattaaatcatctcaatac |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44682673 |
ttatcatcaagtgaagacttgattaaatcatctcaatac |
44682635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University