View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10530_low_1 (Length: 338)
Name: NF10530_low_1
Description: NF10530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10530_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 18 - 331
Target Start/End: Complemental strand, 11119267 - 11118954
Alignment:
| Q |
18 |
atgatcagagcctccacaattgctgcatgacatatatgaaccaggagcacctgatgaagcaaaagaactgctatgttggttttcatactgactcacttga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
11119267 |
atgatcagagcctccacaattgctgcatgacatatatgaaccaggagcacctgatgaagcaaaagaactgttatgttggtttccatactgactcacttga |
11119168 |
T |
|
| Q |
118 |
tttgctggggtcccataatctctaccagtattagtgttgctgtttagaggattatatactggtggcgtagcttgtccagttggaaggctccccggtccag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11119167 |
tttgctggggtcccataatctctaccagtattagtgttgctgtttataggattatatactggtggcgtagcttgtccaattggaaggctccccggtccag |
11119068 |
T |
|
| Q |
218 |
ttgtgttgatagcagagttaatagtggtaccttctgctttctcagacttaagtttatcaatcaaatccagaagagatttagattcagatgcaaagttaac |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11119067 |
ttgtgttgatagcagagttaatagtggtaccttctgctttctcagacttaagtttatcaatcaaatccagaagagatttagattcagatgcaaagttaac |
11118968 |
T |
|
| Q |
318 |
aatcttctctgctt |
331 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
11118967 |
aatcttctctgctt |
11118954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University