View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10530_low_13 (Length: 216)
Name: NF10530_low_13
Description: NF10530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10530_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 17 - 199
Target Start/End: Complemental strand, 47352733 - 47352551
Alignment:
| Q |
17 |
gagaggttttggggaagttaaggtgggagtaaattagtgaagtgagttcatcaaagaaaaataagttgttatttgtttgtttcaaaaggttaaggtttta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47352733 |
gagaggttttggggaagttaaggtgggagtaaattagtgaagtgagttcatcaaagaaaaataagttgttatttgtttgtttcaaaaggttaaggtttta |
47352634 |
T |
|
| Q |
117 |
ggtgcaggatggatattttctgatgatcaaaggggaggggaagagacggtagagagtgggatagaggagagagaaaggcaatt |
199 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47352633 |
ggtggaggatggatattttctgatgatcaaaggggaggggaagagacggtagagagtgggatagaggagagagaaaggcaatt |
47352551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University