View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10530_low_2 (Length: 309)
Name: NF10530_low_2
Description: NF10530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10530_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 1 - 290
Target Start/End: Original strand, 33533183 - 33533472
Alignment:
| Q |
1 |
aaagcacactttgtaatgacaggagttccagaagtcactgcatggtatagttgattttgtggaaggtggttcttgtaaaatttattaagtttcattgatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33533183 |
aaagcacactttgtaatgacaggagttccagaagtcactgcatggtatagttgattttgtggaaggtggttcttgtaaagtttattaagtttcattgatt |
33533282 |
T |
|
| Q |
101 |
ggtaactgatgacttgttttcgattctgaccaggtaatacttgatgtcccaactgtgggaggacggctaatgcttgtcgacatggcaggatcagaaaata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33533283 |
ggtaactgatgacttgttttcgattctgaccaggtaatacttgatgtcccaactgtgggaggacggctaatgcttgtcgacatggcaggatcagaaaata |
33533382 |
T |
|
| Q |
201 |
ttgaacaagctggtcaaactggatttgaggcaaaaatgcaggttattatatttctgccatatcgattctctttctttaatcttgcaggtt |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33533383 |
ttgaacaagctggtcaaactggatttgaggcaaaaatgcaggttattatatttctgccatatcgattctctttttttaatcttgcaggtt |
33533472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University