View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10530_low_3 (Length: 254)
Name: NF10530_low_3
Description: NF10530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10530_low_3 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 36 - 254
Target Start/End: Original strand, 3706062 - 3706280
Alignment:
| Q |
36 |
aaacaaagctacattcctttgtagcaaattcaatctggactcgccattaatctggcgagccccagcagtgacgatgcagaggtcagaccccatcgtcact |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
3706062 |
aaacaaagctacattcctttgtagcaaattcaatctggactcgccattaatctgacgagccccagcagtgacgatgcagaggtcggaacccatcgtcact |
3706161 |
T |
|
| Q |
136 |
gaatagtcagtggaggcctggatcttagtacgggggaggaaggccgcagcatgttgtagatctagcatctcacctcgtagtttgtcaggaatggtgtcaa |
235 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3706162 |
gaatagtcagtggaggcctggatcttagtgcgggggaggaaggccgcagcatgttgtagatccagcatctcacctcgtagtttgtcaggaatggcgtcaa |
3706261 |
T |
|
| Q |
236 |
caagaacaagctcgtcgac |
254 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
3706262 |
caagaacaagctcgtcgac |
3706280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University