View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10530_low_5 (Length: 251)
Name: NF10530_low_5
Description: NF10530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10530_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 98; Significance: 2e-48; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 239240 - 239341
Alignment:
| Q |
1 |
aaaaagatgcttttctcctcattaccataaactcatttggatgtgtggtagagaccatctacatcatattgtacatcatatatgcaccaagggatgcaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
239240 |
aaaaagatgcttttctcctcattaccataaactcatttggatgtgtggtagagaccatctacatcatattgtacatcatctatgcaccaagggatgcaag |
239339 |
T |
 |
| Q |
101 |
gg |
102 |
Q |
| |
|
|| |
|
|
| T |
239340 |
gg |
239341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 192 - 243
Target Start/End: Original strand, 239432 - 239483
Alignment:
| Q |
192 |
gtagaacttaactttcaagttactttcggcaatgaatgtggggtcctttgct |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
239432 |
gtagaacttaactttcaagttactttcggcaatgaatgtggggtcctttgct |
239483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 225223 - 225324
Alignment:
| Q |
1 |
aaaaagatgcttttctcctcattaccataaactcatttggatgtgtggtagagaccatctacatcatattgtacatcatatatgc-accaagggatgcaa |
99 |
Q |
| |
|
||||||||| |||||||| |||||||| ||||| ||||| || || |||||| ||| |||||||| |||||||| || ||||| ||||||| |||||| |
|
|
| T |
225223 |
aaaaagatgaatttctccttattaccattaactcttttgggtgcgtcgtagagctcatttacatcatcttgtacataatctatgcgaccaagg-atgcaa |
225321 |
T |
 |
| Q |
100 |
ggg |
102 |
Q |
| |
|
||| |
|
|
| T |
225322 |
ggg |
225324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University