View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10530_low_8 (Length: 239)
Name: NF10530_low_8
Description: NF10530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10530_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 7546088 - 7545864
Alignment:
| Q |
1 |
tcttgtttttgatttcttaaatgaagtggcaaacaccacctaaaatttgacgctcatatctataaggtcttgagttcgaactcgtgtgaaagtgtctagc |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| ||||||||||||| ||| || ||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7546088 |
tcttgtttttggtttcttaaatgaagtggcaaacaccatctaaaatttgacgttcacatttatgaggtcttgagttcgaactcatgtgaaagtgtctagc |
7545989 |
T |
|
| Q |
101 |
ctaacaatatcgacactatgggaagagacatgccttgaatatgagcttttcttcatcctggcttccttcttttatcttgaatatattttgtcaaaaatta |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7545988 |
ctaacaatatcgacactatggaaagagacatgccttcaatatgagcttttcttcatcttggcttccttcttttatcttgaatatattttgtcaaaaatta |
7545889 |
T |
|
| Q |
201 |
ttttgattatccgtttgaagtttat |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
7545888 |
ttttgattatccgtttgaagtttat |
7545864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University