View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10531_high_5 (Length: 251)
Name: NF10531_high_5
Description: NF10531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10531_high_5 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 102 - 251
Target Start/End: Original strand, 43062205 - 43062354
Alignment:
| Q |
102 |
gaaatacgtagtaacacactggtatcagagctcccaaaagatcataggagtcatgcaaccttccatattgctttgatatgttgatctgttttttcataaa |
201 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43062205 |
gaaatacgtagcaacacactggtatcagagctcccaaaagatcataggagtcatgcaaccttccatattgctttgatatgttgatctgttttttcataaa |
43062304 |
T |
|
| Q |
202 |
atctagttccgatttccaatgttttttgtcactgattcgtattactgacc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43062305 |
atctagttccgatttccaatgttttttgtcactgattcgtattattgacc |
43062354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University