View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10531_low_7 (Length: 263)
Name: NF10531_low_7
Description: NF10531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10531_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 45 - 251
Target Start/End: Complemental strand, 43574966 - 43574760
Alignment:
| Q |
45 |
acggggaagacgagtttggttcttagatttgtcaaaggtcaattttcggaataccaggttgctatatgattgtttcttttcattatgtcttcacatcatt |
144 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43574966 |
acggggaagactagtttggttcttagatttgtcaaaggtcaattttcggaataccaggttgctatatgattgtttcttttctttatgtcttcacatcatt |
43574867 |
T |
 |
| Q |
145 |
atagatgacttaaattattgatnnnnnnngaagataatttaatttggattaccttaaattaatgtgtgcaggaatcaacaatcggagcggcatttttcac |
244 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||| |||||||||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43574866 |
atagatgactcaaattattgataaaaaaataagataatttaatttgaattaccttaaatgaatgtgtgcaggaatcaacaatcggagccgcatttttcac |
43574767 |
T |
 |
| Q |
245 |
acaggtt |
251 |
Q |
| |
|
||||||| |
|
|
| T |
43574766 |
acaggtt |
43574760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University