View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10532_high_1 (Length: 250)
Name: NF10532_high_1
Description: NF10532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10532_high_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 37865101 - 37865340
Alignment:
| Q |
1 |
attctactaaagattctaactaacttattttcttcttagttccattcaacttccctctcaagccatgcttcgttgacatagccattatcagttcatgcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37865101 |
attctactaaagattctaactaacttattttcttcttagttccattcaacttccctctcaagccatgcttcgttgacatagccattatcagttcatgcaa |
37865200 |
T |
 |
| Q |
101 |
ggttggccgcaacactgtgctatgaatcattaatgaaactgatattaactttcttaaacttggtaaaacctctcaaatttacaatattcagctctaaaac |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37865201 |
ggttggctgcaacactgtgctatgaatcattaatgatactgatattaactttcttaaacttggtaaaacctctcaaatttacaatcttcagctctaaaac |
37865300 |
T |
 |
| Q |
201 |
tatttcttgcaatcgaattgataatatctcataccctttg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37865301 |
tatttcttgcaatcgaattgataatatctcataccctttg |
37865340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University