View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10532_high_2 (Length: 239)
Name: NF10532_high_2
Description: NF10532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10532_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 37865024 - 37864837
Alignment:
| Q |
1 |
aaactacttaccgaaccagttgtacaattttaacccatcaatggcatgaaccacttaatcatatacgaccttaaaactaaaaattagaactaataatatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37865024 |
aaactacttaccgaaccagttgtacaattttaacccatcaatggcatgaaccacttaatcatatacgaccttaaaactaaaaattagaactaataatatg |
37864925 |
T |
 |
| Q |
101 |
caattagatacgactctgaggtacaaatatttagtaactgaaacatcttaagtaagattaagttcgattgattgaacctatatcaaat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37864924 |
caattagatacgactctgaggtacaaatatttagtaactgaaacatcttaaataagattaagttcgattgattgaaccgatatcaaat |
37864837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University