View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10532_low_2 (Length: 323)
Name: NF10532_low_2
Description: NF10532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10532_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 317
Target Start/End: Original strand, 23072158 - 23072474
Alignment:
| Q |
1 |
aacaaaatcaaatcaaggattagggaataatnnnnnnnnnnnnntatgcaacatacgtttatctgcttctgaacctttttaggcctcttaatgggcctct |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23072158 |
aacaaaatcatatcaaggattagggaataattaaaaaggaaaaatatgcgacatacgtttatctgcttctgaacctttttaggcctcttaatgggcctct |
23072257 |
T |
 |
| Q |
101 |
gccgcggtgcacgacccaaaaacgtcatgaaatcttcctccttttccttccttaaaataggaatgcaaaattttggcatttcgatcttattactatcaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23072258 |
gccgcggtgcacgacccaaaaacgtcaagaaatcttcctccttttccttccttgaaataggaatgcaaaattttggcctttcgatcttattactatcaac |
23072357 |
T |
 |
| Q |
201 |
attacttctcaaccttgtcgacacaaggtcatcgtctctggccacgacaccatcatttctcactagagaagcggtaattggagctttcatcactcttttt |
300 |
Q |
| |
|
| | ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23072358 |
aatgcttctcaaccttgacgacacaaggtcatcgtctctggccacgacaccatcatttctcacttgagaagcggtaattggagctttcatcactcttttt |
23072457 |
T |
 |
| Q |
301 |
tgcctacttcttctcac |
317 |
Q |
| |
|
|| |||| ||||||||| |
|
|
| T |
23072458 |
tgtctacctcttctcac |
23072474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University