View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10533_low_9 (Length: 222)
Name: NF10533_low_9
Description: NF10533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10533_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 6e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 18 - 150
Target Start/End: Complemental strand, 25495548 - 25495416
Alignment:
| Q |
18 |
gtatcaacaaaactccacgataagcatttatatattaaaatctagataaacataaatgatttattattcaaaataatctccaagccaaaactctataaat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25495548 |
gtatcaacaaaactccacgataagcatttatatcttaaaatctagataaacataaatgatttattattcaaaataatctccaagccaaaactctataaat |
25495449 |
T |
|
| Q |
118 |
taatagaagttagtggtatcaattgcaaaccaa |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
25495448 |
taatagaagttagtggtatcaattgcaaaccaa |
25495416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 169 - 218
Target Start/End: Complemental strand, 25495423 - 25495374
Alignment:
| Q |
169 |
caaaccaaccatgaagcctgcactacttaccttccctttgcttctcctct |
218 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||| |||| ||||| |||| |
|
|
| T |
25495423 |
caaaccaacaatgaagccttcactacttaccttctcttttcttcttctct |
25495374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University