View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10534_7 (Length: 411)
Name: NF10534_7
Description: NF10534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10534_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 2e-93; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 71 - 244
Target Start/End: Original strand, 30083946 - 30084119
Alignment:
| Q |
71 |
gctctcattggcttgcccaaaattaacaacacaaaaagcttcaactcatttactcaatattctatttaaagaggcaatttagaaaccgtacaaatgatgc |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30083946 |
gctctcattggcttgcccaaaattaacaacacaaaaagcttcaactcatttactcaatattctatttaaagaggcaatttagaaaccgtacaaatgatgc |
30084045 |
T |
|
| Q |
171 |
atgttgttctctcgtctcgtactaattaccaactaaaaacatttacaattcgtacggtttctcaaatggcacat |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30084046 |
atgttgttctctcgtctcgtactaattaccaactaaaaacatttacaattcgtacggtttctcaaatggcacat |
30084119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 300 - 411
Target Start/End: Original strand, 30084175 - 30084286
Alignment:
| Q |
300 |
ttcctacttcaattgtgatgattaatttagacagattctaagttcggtacatttttactagctggtaatagcaaattcctacaaactggacacgaaccat |
399 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30084175 |
ttcccacttcaattgtgatgattaatttagacagattctaagttcggtacatttttactagctggtaatagcaaattcctacaaactggacacgaaccat |
30084274 |
T |
|
| Q |
400 |
taaccttcaacc |
411 |
Q |
| |
|
|||||||||||| |
|
|
| T |
30084275 |
taaccttcaacc |
30084286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University