View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10534_low_3 (Length: 306)
Name: NF10534_low_3
Description: NF10534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10534_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 19 - 298
Target Start/End: Original strand, 27243541 - 27243820
Alignment:
| Q |
19 |
agaagcacccactttggttgattgttttcgtgatcattggtaactcatttctcatttcctccnnnnnnnnnnnnnttatatgtaattgacttttcttgcc |
118 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
27243541 |
agaagcacccactttggttgatcgttttcgtgatcattggtaactcatttctcatttcctccaaaaaaaaataa-ttacatgtaattgacttttcttgcc |
27243639 |
T |
|
| Q |
119 |
ccttgtgatttaatctgactttgcaattgatgaagatttaaagagttannnnnnnnnnnnnn-aacaatcaatgacaaagagttgaaaaaagacattctc |
217 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27243640 |
ccttttgatttaatctgactttgcaattgatgaagatttaaagagttctttttagttttttttaacaatcaatgacaaagagttgaaaaaagacattctc |
27243739 |
T |
|
| Q |
218 |
ttgcaggaagtcttggatccttggaacaatattcaccatacttctatcttttattactagagggaaatggggacctttgct |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27243740 |
ttgcaggaagtcttggatccttggaacaatattcaccatacttctatcctttattactagagggaaatggggacctttgct |
27243820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University