View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10534_low_6 (Length: 268)
Name: NF10534_low_6
Description: NF10534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10534_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 15 - 252
Target Start/End: Complemental strand, 3811860 - 3811623
Alignment:
| Q |
15 |
aagaagaagtggaaagttagtataaatgtaaaaaattacttaagttttcttcaccataatatctctagtctcttgagggacttgaggtagttgtatgtca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3811860 |
aagaagaagtggaaagttagtataaatgtaaaaaattacttaagttttcttcaccataatatctctagtctcttgagggacttgaggtagttgtatgtca |
3811761 |
T |
|
| Q |
115 |
agaaagtagaggagatataagcatgaagtgacgaatcacaatttgtgagctatttttgtcnnnnnnncttatattatggttatgcacttgggctatagct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3811760 |
agaaagtagaggagatataagcatgaagtgacgaatcacaatttgtgagctatttttgtctttttttcttatattatggttatgcacttgggctatagct |
3811661 |
T |
|
| Q |
215 |
tgatagaaattttctctccaacatcttaccatattatc |
252 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
3811660 |
tgatagaaattttgtctccaacatcttaccatcttatc |
3811623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University