View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10534_low_8 (Length: 215)
Name: NF10534_low_8
Description: NF10534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10534_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 123 - 200
Target Start/End: Complemental strand, 19397722 - 19397646
Alignment:
| Q |
123 |
tgatgacaaatgttgagaagagtggaaaggtacctgcctttttcttgagctatacaaaagacaaactatttacttttt |
200 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19397722 |
tgatgaaaaatgttgagaagagtgaaaaggtacctgcctttttcttgagctatacaaaagac-aactatttacttttt |
19397646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University