View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10535_high_1 (Length: 370)
Name: NF10535_high_1
Description: NF10535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10535_high_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 19 - 360
Target Start/End: Complemental strand, 1111926 - 1111585
Alignment:
| Q |
19 |
ataaccaggaggaccaatgtgtgaggccatttcctttctcatctgcacaatttatttaaataaataaataaacatttttgaacacaacccattgatgggg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1111926 |
ataaccaggaggaccaatgtgtgaggccatttcctttctcatctgcacaatttatttaaataaataaataaacatttttgaacacaacccattgatgggg |
1111827 |
T |
 |
| Q |
119 |
tttgaaaattgaagttaaaaattgaaactttagttaggttgagaaagataacatacgagggcgggtttaggttgataaatagcgacttcatcttgagggg |
218 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1111826 |
tttgaaaattgaagttaaaaaatgaaactttagttaggttgagaaagataacatacgagggcgggtttaggttgataaatagcgacttcatcttgagggg |
1111727 |
T |
 |
| Q |
219 |
tataaccagctctgatgcgaactggttttcggagtgtaccatcgggtcgacgggtcggggcgaggatccgttcaccatcttttggttgcttctgcttcac |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1111726 |
tataaccagctctgatgcgaactggttttcggagtgtaccatcgggtcgacgggtcggggcgaggatccgttcaccatcttttggttgcttctgcttcac |
1111627 |
T |
 |
| Q |
319 |
ttgttgttgatcttcactcgtcgacatcactctttctctgct |
360 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1111626 |
ttgtcgttgatcttcactcgtcgacatcactctttctctgct |
1111585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University