View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10535_low_3 (Length: 296)
Name: NF10535_low_3
Description: NF10535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10535_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 291
Target Start/End: Complemental strand, 28591296 - 28591006
Alignment:
| Q |
1 |
tcacattttcctcaattccacaccgactctcattacgataacttctatgtcaatgccaatggtaacttaactcttacgccatttttcaacttcttccttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28591296 |
tcacattttcctcaattccacaccgactctcattacgataacttctatgtcaatgccaatggtaacttaactctaacgccatttttcaacttcttccttt |
28591197 |
T |
 |
| Q |
101 |
taaccaaacactccttaatcannnnnnnnnnaggtttgatgagtttcatggattcggcgaagatgggagattttgttgagaagaatcggaattctggttt |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28591196 |
taaccaaacactccttaatcattttttttttaggtttgatgagtttcatggattcggcgaagatgggagattttgttgagaagaatcggaattctggttt |
28591097 |
T |
 |
| Q |
201 |
actatatgatcttaactctacttcggtgtttttcggtgatgaacatgatcttaataaatcagttgttgaatttcaaggtgtctctgcttct |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
28591096 |
actatatgatcttaactctacttcggtgtttttcggtgataaacatgatcttaataaatcagttgttgaatttcaaggtgtttctggttct |
28591006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University