View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10535_low_4 (Length: 283)
Name: NF10535_low_4
Description: NF10535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10535_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 2 - 261
Target Start/End: Complemental strand, 41637206 - 41636949
Alignment:
| Q |
2 |
tgttggtttccgtttgaacttattcgannnnnnngaaaggttatttggttttgcgtcaatattaagagatatttggttaaagagaaaggaaggaacaagt |
101 |
Q |
| |
|
||||||||||||| ||||||| || || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41637206 |
tgttggtttccgtatgaacttgtttgatttttttgaaaggttatttggttttgcgtcaatattaagagatatttggttaaagagaaaggaaggaacaagt |
41637107 |
T |
 |
| Q |
102 |
gaacggttagaagtggaaaagagaaggaatggaaagttgatgttgaagagtgaaagagagtgtggaattgcttgttgttgaagaaagtgttgtaagatga |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41637106 |
gaacggttagaagtggaaaagagaaggaatggagagttgatgttgaagagtgaa--agagtgtggaattgcttgttgttgaagaaagtgttgtaagatga |
41637009 |
T |
 |
| Q |
202 |
gttagttttggaagtgaacttttgaattttgaaagacagtttgaattaggtaaatgatgt |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41637008 |
gttagttttggaagtgaacttttgaattttgaaagacagtttgaattaggtaaatgatgt |
41636949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University