View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10536_4 (Length: 385)
Name: NF10536_4
Description: NF10536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10536_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 1e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 12 - 247
Target Start/End: Complemental strand, 27527862 - 27527627
Alignment:
| Q |
12 |
aaaaatgttgttttggaaggctttaaaataaagtaagataagtaattttctgtgagaatactgatcagaccttggtttagacccnnnnnnnnnnnnaata |
111 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | | |||||||||||||||||| |||| |
|
|
| T |
27527862 |
aaaaatgttgttttgaaaggctttaaaataaagtaagataagtaattttctgtgagaattatactgagaccttggtttagacccttttttatttttaata |
27527763 |
T |
 |
| Q |
112 |
gacagagaatggataatagatgagcnnnnnnnn-aaagaacaaaatatctaacttcagttcacctttttatcaatttgtttttattcattgtaaactatt |
210 |
Q |
| |
|
|| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
27527762 |
gatagagaatggataatagatgagctctttttttaaagaacaaaatatctaacttcagttcacctttttatcaatttgtttttattcattgtaaacta-t |
27527664 |
T |
 |
| Q |
211 |
annnnnnnngaatggataataaagtagttgttttctt |
247 |
Q |
| |
|
| |||||||||||||||||||||||||||| |
|
|
| T |
27527663 |
attttttttgaatggataataaagtagttgttttctt |
27527627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University