View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10536_low_2 (Length: 243)

Name: NF10536_low_2
Description: NF10536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10536_low_2
NF10536_low_2
[»] chr3 (5 HSPs)
chr3 (6-100)||(8349969-8350064)
chr3 (164-209)||(8349624-8349669)
chr3 (2-64)||(8260574-8260636)
chr3 (2-38)||(8352758-8352794)
chr3 (2-52)||(8334018-8334069)
[»] chr1 (1 HSPs)
chr1 (174-224)||(44799682-44799732)


Alignment Details
Target: chr3 (Bit Score: 60; Significance: 1e-25; HSPs: 5)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 6 - 100
Target Start/End: Complemental strand, 8350064 - 8349969
Alignment:
6 tagtttcttatttccctgttaactattatccctcgcgcttgtagtcatgtagtattaatttacatctgctactt-atcaagaagagtgtaatcaac 100  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||| | | |||||||||||||||||||| || |  |||||||||||||||    
8350064 tagtttcttatttccctgttaactattatccctcacgcttgtagtcatgcaatgttaatttacatctgctacttaattatcaagagtgtaatcaac 8349969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 164 - 209
Target Start/End: Complemental strand, 8349669 - 8349624
Alignment:
164 ttcaatgattggttgcttgcggcacaagaatctggttcagcttaaa 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
8349669 ttcaatgattggttgcttgcggcacaagaatctggttcagcttaaa 8349624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 2 - 64
Target Start/End: Complemental strand, 8260636 - 8260574
Alignment:
2 attgtagtttcttatttccctgttaactattatccctcgcgcttgtagtcatgtagtattaat 64  Q
    |||||||||||||||||||||||||||| ||||| ||| || ||||||||||| |||||||||    
8260636 attgtagtttcttatttccctgttaactcttatctctcacgtttgtagtcatgcagtattaat 8260574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 2 - 38
Target Start/End: Complemental strand, 8352794 - 8352758
Alignment:
2 attgtagtttcttatttccctgttaactattatccct 38  Q
    |||||||||||||||||||||||||||||||||||||    
8352794 attgtagtttcttatttccctgttaactattatccct 8352758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 2 - 52
Target Start/End: Complemental strand, 8334069 - 8334018
Alignment:
2 attgtagtttcttatttccctgttaactattat-ccctcgcgcttgtagtca 52  Q
    |||||||||||||||||||  |||||||||||| ||||| ||||||||||||    
8334069 attgtagtttcttatttcctcgttaactattatcccctcacgcttgtagtca 8334018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 174 - 224
Target Start/End: Original strand, 44799682 - 44799732
Alignment:
174 ggttgcttgcggcacaagaatctggttcagcttaaaggacagtgttgtgaa 224  Q
    ||||||||||||||||||||||||||||||||||||||   ||||||||||    
44799682 ggttgcttgcggcacaagaatctggttcagcttaaagggtggtgttgtgaa 44799732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University