View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10536_low_2 (Length: 243)
Name: NF10536_low_2
Description: NF10536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10536_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 60; Significance: 1e-25; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 6 - 100
Target Start/End: Complemental strand, 8350064 - 8349969
Alignment:
| Q |
6 |
tagtttcttatttccctgttaactattatccctcgcgcttgtagtcatgtagtattaatttacatctgctactt-atcaagaagagtgtaatcaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| | | |||||||||||||||||||| || | ||||||||||||||| |
|
|
| T |
8350064 |
tagtttcttatttccctgttaactattatccctcacgcttgtagtcatgcaatgttaatttacatctgctacttaattatcaagagtgtaatcaac |
8349969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 164 - 209
Target Start/End: Complemental strand, 8349669 - 8349624
Alignment:
| Q |
164 |
ttcaatgattggttgcttgcggcacaagaatctggttcagcttaaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8349669 |
ttcaatgattggttgcttgcggcacaagaatctggttcagcttaaa |
8349624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 2 - 64
Target Start/End: Complemental strand, 8260636 - 8260574
Alignment:
| Q |
2 |
attgtagtttcttatttccctgttaactattatccctcgcgcttgtagtcatgtagtattaat |
64 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||| || ||||||||||| ||||||||| |
|
|
| T |
8260636 |
attgtagtttcttatttccctgttaactcttatctctcacgtttgtagtcatgcagtattaat |
8260574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 2 - 38
Target Start/End: Complemental strand, 8352794 - 8352758
Alignment:
| Q |
2 |
attgtagtttcttatttccctgttaactattatccct |
38 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8352794 |
attgtagtttcttatttccctgttaactattatccct |
8352758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 2 - 52
Target Start/End: Complemental strand, 8334069 - 8334018
Alignment:
| Q |
2 |
attgtagtttcttatttccctgttaactattat-ccctcgcgcttgtagtca |
52 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||| |||||||||||| |
|
|
| T |
8334069 |
attgtagtttcttatttcctcgttaactattatcccctcacgcttgtagtca |
8334018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 174 - 224
Target Start/End: Original strand, 44799682 - 44799732
Alignment:
| Q |
174 |
ggttgcttgcggcacaagaatctggttcagcttaaaggacagtgttgtgaa |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44799682 |
ggttgcttgcggcacaagaatctggttcagcttaaagggtggtgttgtgaa |
44799732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University