View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10537_low_2 (Length: 304)
Name: NF10537_low_2
Description: NF10537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10537_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 23924663 - 23924435
Alignment:
| Q |
1 |
attatgttaaattggtggctacctgttttggatccactatggtcacgaaaaaatcagtatcatttgtgtgctcagaagctgatgagtatctgcaatacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
23924663 |
attatgttaaattggtggctacctgttttggatccactatggtcacgaaaaaatcagtatcatttgtgtgctcagaaggttatgagtatctgcaatacat |
23924564 |
T |
|
| Q |
101 |
ctctcatacattaacttaaagaaaaaattaaatgaatcttaattcta--atgcaaatttcaaagcagttatggaaattttgatagtttttacgcactcta |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23924563 |
ctctcatacattaacttaaagaaaaaattaaatgaatcttaattataacatgcaaatttcaaagcagttatggaaattttgatagtttttacgcactcta |
23924464 |
T |
|
| Q |
199 |
ttatataattgtggtcttcaattttgata |
227 |
Q |
| |
|
||||||||||||||||||| ||||||||| |
|
|
| T |
23924463 |
ttatataattgtggtcttctattttgata |
23924435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 231 - 294
Target Start/End: Complemental strand, 23923508 - 23923444
Alignment:
| Q |
231 |
tttttggtttg-cttcaggaaacaaaacttattcaggtagatgattttgtgtgttcttctctgtg |
294 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23923508 |
tttttggtttgtctttaggaaacaaaacttattcaggtagatgattttgtgtgttcttctttgtg |
23923444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 248 - 288
Target Start/End: Original strand, 24923851 - 24923891
Alignment:
| Q |
248 |
gaaacaaaacttattcaggtagatgattttgtgtgttcttc |
288 |
Q |
| |
|
||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
24923851 |
gaaactaaacttatgcagttagatgattttgtgtgttcttc |
24923891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University