View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10538_high_14 (Length: 226)
Name: NF10538_high_14
Description: NF10538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10538_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 110 - 212
Target Start/End: Complemental strand, 52380322 - 52380220
Alignment:
| Q |
110 |
gagaagactgcactacttaatgggccgggcttgtcattttcactaatgggtacccggtactttttatcaaattaataggctattacttttcccacctatg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52380322 |
gagaagactgcactacttaatgggccgggcttgtcattttcactaatgggtacccggtactttttatcaaattaatagactattacttttcccacctatg |
52380223 |
T |
|
| Q |
210 |
ctt |
212 |
Q |
| |
|
||| |
|
|
| T |
52380222 |
ctt |
52380220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University