View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10538_high_5 (Length: 309)
Name: NF10538_high_5
Description: NF10538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10538_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 9 - 291
Target Start/End: Original strand, 8985804 - 8986092
Alignment:
| Q |
9 |
agtgataaagttaatgaaaccaatgtggtggacagagcaaaacatatgcttgaccaatggttggcaactcaaatgg-----aattcagtgaatgcaccta |
103 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8985804 |
agtgataaagttaatgaagccaatgtggtggacagagcaaaacatatgcttgaccagtggttggcaactcaaatggtacacaattcagtgaatgcaccta |
8985903 |
T |
 |
| Q |
104 |
taatacatgttggaagggcaaaacggttgaagccacaataagggatatttaaatgtaatgtagatgcatctttttccaaagaggataaaaaagttgggat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||| |||| |||||||||||| ||||||||||| |
|
|
| T |
8985904 |
taatacatgttggaagggcaaaacggttgaagccacaacaaatgatatttaaatgtaatgtagatgcatcctttttcaaagaggataacaaagttgggat |
8986003 |
T |
 |
| Q |
204 |
cggtatgtgcattcc-agattatacatgaacttttgttttggctagaacataatggtttagtccaatctgtgatgttcatatatagatg |
291 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||| ||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
8986004 |
cggtatgtgcattccaagattatacataaacttttgctttggctagaacataatggtttagttcaatttgtgatgttcatatatagatg |
8986092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University