View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10538_low_15 (Length: 338)
Name: NF10538_low_15
Description: NF10538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10538_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 18 - 328
Target Start/End: Complemental strand, 35696891 - 35696581
Alignment:
| Q |
18 |
catttgtattgaattgttgatggatatggaaggtgaacaagtacaacgataactggaagaaacaatggttcggagcaggaatattctacgaaggaagcga |
117 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35696891 |
catttgtgttgaattgttgatggatatggaaggtgaacaagtacaatgataactggaagaaacaatggttcggagcaggaatattctacgaaggaagcga |
35696792 |
T |
|
| Q |
118 |
agaagtagaagtcgacgtattcaagaaacttgagaaacgcaaagtattaagcaacgttgaaaaagcaggattattatccaaagctgaagagttcggagtc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35696791 |
agaagtagaagtcgacgtattcaagaaacttgagaaacgcaaagtattaagcaacgttgaaaaagcaggattattatccaaagctgaagagttcggagtc |
35696692 |
T |
|
| Q |
218 |
acgctctcttcaatcgagaagctaggtcttttttctaaggcagaagaacttggtttactcagcttattagagaaactcgccgcggtctctccttccgttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35696691 |
acgctctcttcaatcgagaagctaggtcttttttctaaggcagaagaacttggtttactcagcttattagagaaactcgccgcggtctctccttccgttt |
35696592 |
T |
|
| Q |
318 |
tggcttctctg |
328 |
Q |
| |
|
||||||||||| |
|
|
| T |
35696591 |
tggcttctctg |
35696581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University