View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10538_low_27 (Length: 260)
Name: NF10538_low_27
Description: NF10538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10538_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 92; Significance: 9e-45; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 84 - 183
Target Start/End: Original strand, 39939253 - 39939352
Alignment:
| Q |
84 |
gagaaaatataagctgacacccttttgtttgtaccaccctatgtggcatgggtatcttggtaattttacctcaaaactacaaccactctttaatccactg |
183 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39939253 |
gagaaaatataagttgacacccttttgtttgtaccaccctatgtggcatgggtatcttggtaattttacctcaaaattacaaccactctttaatccactg |
39939352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 64; Significance: 5e-28; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 112 - 183
Target Start/End: Original strand, 52623476 - 52623547
Alignment:
| Q |
112 |
ttgtaccaccctatgtggcatgggtatcttggtaattttacctcaaaactacaaccactctttaatccactg |
183 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52623476 |
ttgtaccatcctatgtggtatgggtatcttggtaattttacctcaaaactacaaccactctttaatccactg |
52623547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 124 - 182
Target Start/End: Complemental strand, 42101194 - 42101136
Alignment:
| Q |
124 |
atgtggcatgggtatcttggtaattttacctcaaaactacaaccactctttaatccact |
182 |
Q |
| |
|
|||||| |||| |||||||||||||| |||||||||| |||||| ||||| ||||||| |
|
|
| T |
42101194 |
atgtggtatggatatcttggtaatttcacctcaaaaccacaacctttctttcatccact |
42101136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 88 - 120
Target Start/End: Original strand, 52623441 - 52623473
Alignment:
| Q |
88 |
aaatataagctgacacccttttgtttgtaccac |
120 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
52623441 |
aaatataagttgacacccttttgtttgtaccac |
52623473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 64; Significance: 5e-28; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 112 - 183
Target Start/End: Complemental strand, 9810321 - 9810250
Alignment:
| Q |
112 |
ttgtaccaccctatgtggcatgggtatcttggtaattttacctcaaaactacaaccactctttaatccactg |
183 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9810321 |
ttgtaccatcctatgtggtatgggtatcttggtaattttacctcaaaactacaaccactctttaatccactg |
9810250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 112 - 182
Target Start/End: Complemental strand, 16249347 - 16249277
Alignment:
| Q |
112 |
ttgtaccaccctatgtggcatgggtatcttggtaattttacctcaaaactacaaccactctttaatccact |
182 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||| |||||||||| ||| ||||||||||||||||| |
|
|
| T |
16249347 |
ttgtaccaccctatgtggcatgggcatctaagtaatttcacctcaaaaccacacccactctttaatccact |
16249277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 115 - 182
Target Start/End: Complemental strand, 45624061 - 45623994
Alignment:
| Q |
115 |
taccaccctatgtggcatgggtatcttggtaattttacctcaaaactacaaccactctttaatccact |
182 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||| |||||||||| ||| | ||||||||||||||| |
|
|
| T |
45624061 |
taccaccctatgtggcatgggcatctaagtaatttcacctcaaaaccacacctactctttaatccact |
45623994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 38 - 76
Target Start/End: Complemental strand, 217645 - 217607
Alignment:
| Q |
38 |
gtacggaccttgcaagttctaatatcatttcaacgtaat |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
217645 |
gtacggaccttgcaagttctaatatcatttcaacgtaat |
217607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 88 - 120
Target Start/End: Complemental strand, 9810356 - 9810324
Alignment:
| Q |
88 |
aaatataagctgacacccttttgtttgtaccac |
120 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
9810356 |
aaatataagttgacacccttttgtttgtaccac |
9810324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 99 - 182
Target Start/End: Original strand, 31887950 - 31888033
Alignment:
| Q |
99 |
gacacccttttgtttgtaccaccctatgtggcatgggtatcttggtaattttacctcaaaactacaaccactctttaatccact |
182 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |||| ||||||| |||||||||| ||| ||||||||||||||||| |
|
|
| T |
31887950 |
gacacccttttatttgtaccaccctatgtggcatgggcatctaagtaatttcacctcaaaaccacacccactctttaatccact |
31888033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 113 - 182
Target Start/End: Complemental strand, 34579482 - 34579413
Alignment:
| Q |
113 |
tgtaccaccctatgtggcatgggtatcttggtaattttacctcaaaactacaaccactctttaatccact |
182 |
Q |
| |
|
||||||| ||||||||||||||| |||| ||| ||| |||||||||| ||| ||||||||||||||| |
|
|
| T |
34579482 |
tgtaccatcctatgtggcatgggcatctaagtagtttcacctcaaaaccacacatactctttaatccact |
34579413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 118 - 166
Target Start/End: Original strand, 15484710 - 15484758
Alignment:
| Q |
118 |
caccctatgtggcatgggtatcttggtaattttacctcaaaactacaac |
166 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| |||||||||| ||||| |
|
|
| T |
15484710 |
caccctatgtagcatgggcttcttggtaatttcacctcaaaaccacaac |
15484758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University