View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10538_low_30 (Length: 250)
Name: NF10538_low_30
Description: NF10538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10538_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 36262143 - 36262008
Alignment:
| Q |
1 |
tatcattagccataagtgatagagaacaaggaaactatttagaaa--------caaacaacacaatacgctgtgttatgtcttgcctcctcaacctgaaa |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
36262143 |
tatcattagccataagtgatagagaacaaggaaactatttagaaatttagaaacaaacaacacaatacgctgtgttatgtcttgcctcctcaacctcaaa |
36262044 |
T |
|
| Q |
93 |
taaacgactccaatttataggcagacagttaggtac |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
36262043 |
taaacgactccaatttataggcagacagttaggtac |
36262008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 201 - 237
Target Start/End: Complemental strand, 36261934 - 36261898
Alignment:
| Q |
201 |
attcgacaaacaactatttaggtcatgcgttatccct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36261934 |
attcgacaaacaactatttaggtcatgcgttatccct |
36261898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University