View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10538_low_32 (Length: 249)
Name: NF10538_low_32
Description: NF10538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10538_low_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 11269973 - 11270211
Alignment:
| Q |
1 |
tttagtgcttggacaaatccttttcatcttttcttttattgatacgtgatctcaatcttatcatgttgtatgatatttgtctctattgtctttttcttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11269973 |
tttagtgcttggacaaatccttttcatcttttcttttattgatacgtgatctcaatcttatcatgttgtatgatatttgtctctattgtctttttcttat |
11270072 |
T |
|
| Q |
101 |
gcttatataaagcatcaattgtcgtttaatattgactaatctgctttaaaaaatgtattgggttcacaattgaatttttacacagataaggttcggagag |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11270073 |
gcttatataaagtatcaattgtcgtttaatattgactaatctgctttaaaaaatgtattgggttcacaatcgaatttttacacagataaggttcggagag |
11270172 |
T |
|
| Q |
201 |
cgaacatttaaccacttgcttgaaatgcaatagtttctt |
239 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11270173 |
cgaacatttaaccacttgattgaaatgcaatagtttctt |
11270211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University