View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10538_low_33 (Length: 249)
Name: NF10538_low_33
Description: NF10538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10538_low_33 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 6780790 - 6781033
Alignment:
| Q |
1 |
ccatcctcaaatgaaacctttttgacagtgaagccataactttcggaggaatttttctcactctgaaagcactttggaagtatgcatcgcataaaacata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
6780790 |
ccatcctcaaatgaaacctttttgacagtgaaggcataactttcggaggaatttttctcactctaaaagcactttggaagtacgcatcccataaaacata |
6780889 |
T |
|
| Q |
101 |
atttgtatactctaaatatgtattttctaacaaaa--acaattttcttcttgtttaaatgtatatctatgaaattatgtgcgggtttttagaaagacagg |
198 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
6780890 |
atttgtatactctaaatgtgtattttctaacaaaaacacaattttcttcttgtttaaatgtatatttatgaaattatgtgcgggtgtttagaaagacagg |
6780989 |
T |
|
| Q |
199 |
tgagtgaagttctctctagctttccctattacttatctgtggta |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6780990 |
tgagtgaagttctctctagctttccctattacttatctgtggta |
6781033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University