View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10538_low_38 (Length: 233)
Name: NF10538_low_38
Description: NF10538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10538_low_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 20 - 215
Target Start/End: Original strand, 28820814 - 28821009
Alignment:
| Q |
20 |
gaaggtagacacttggagttagtcgacaagacattgaaccctagtgactatgatgcagaagaagtgaagaaagttatcgagattgctttgctttgcactc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28820814 |
gaaggtagacacttggagttagtcgacaagacattgaaccctggtgactatgatgcagaagaagtgaagaaagttatcgagattgctttgctttgcactc |
28820913 |
T |
 |
| Q |
120 |
aagcaacagcggctacaaggccaactatgtcagaaatagtagttctactcaaaagcaagaacttcatggagcatatgaaaccaaccatgcctgtct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28820914 |
aagcaacagcggctacaaggccaactatgtcagaaatagtagttctactcaaaagcaagaacttcatggagcatatgaaaccaaccatgcctgtct |
28821009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 29 - 129
Target Start/End: Original strand, 28827294 - 28827394
Alignment:
| Q |
29 |
cacttggagttagtcgacaagacattgaaccctagtgactatgatgcagaagaagtgaagaaagttatcgagattgctttgctttgcactcaagcaacag |
128 |
Q |
| |
|
||||||||| ||||||||||| || |||||| |||||||||| |||||||||||||||| | || |||||||||||| | || ||||||||| ||| |
|
|
| T |
28827294 |
cacttggagctagtcgacaaggtcttagaccctaacgactatgatggagaagaagtgaagaaaatgatagagattgctttgttgtgtactcaagcatcag |
28827393 |
T |
 |
| Q |
129 |
c |
129 |
Q |
| |
|
| |
|
|
| T |
28827394 |
c |
28827394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 129
Target Start/End: Original strand, 28836661 - 28836733
Alignment:
| Q |
57 |
accctagtgactatgatgcagaagaagtgaagaaagttatcgagattgctttgctttgcactcaagcaacagc |
129 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||| | || ||||||||| || | || ||||||||| |||| |
|
|
| T |
28836661 |
accctaatgactatgatggagaagaagtgaagaaaatgatagagattgctctgttgtgtactcaagcatcagc |
28836733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University